Molecular basis for a geographic variation of varicella-zoster virus recognized by a peptide antibody

In westernized societies, the majority of varicella cases occur during childhood and are naturally selflimiting, with few long-term effects on health. However, varicella can have serious consequences in the immunocompromised, pregnant women, and newborns. It is also frequently more severe and complicated in adults, a problem common in third-world countries where primary infection often occurs later in life. In an approach to reduce the morbidity and mortality associated with varicella, a live attenuated varicella vaccine (LAVV) was developed by Takahashi et al. ^[1] Derived by passage of a Japanese varicella isolate in semipermissive guinea pig embryo fibroblasts, it has proved to be quite successful at preventing varicella and is now undergoing extensive clinical trial assessment to determine its suitability for widespread vaccination programs. Although LAVV induces protection from disease, it is not without problems. Evidence suggests that LAVV may not necessarily prevent wild-type varicella-zoster virus (VZV) infection, may even recombine with wild-type virus in vivo, and can itself go latent, reactivate, and cause zoster. ^[2,3]

The differentiation of LAVV from wild-type strains has been central in the epidemiologic and etiologic assessment of LAVV in clinical trials. This has largely been achieved by characterization of viral DNA fragments following restriction enzyme digestion and electrophoretic separation. Several VZV DNA fragments resulting from digestion with the enzymes Hpa I, BamHI, and Bgl I show mobilities characteristic of LAVV, either because of variations in the copy numbers of short, direct-repeat elements located in five regions of the VZV genome, ^[4] or, more rarely, as a result of DNA polymorphisms which affect the presence or absence of restriction enzyme sites. ^[5]

We have found and characterized two polymorphisms located in VZV open reading frame (ORF) 10, one of which appears to be geographically restricted to Japanese VZV strains. It was originally identified by antibodies directed against a synthetic peptide of ORF 10. The antibodies, which have been previously described, ^[6] are directed against the peptide YMECNLGTEHPSTDT, corresponding to the published N-terminal 14-amino-acid sequence of ORF 10 in the Dumas strain of VZV. ^[4] The antibodies react with a VZV-specific 47-kd polypeptide which is also a virion structural protein. ^[6] Extension of these studies has revealed that the antibodies do not react specifically with 47-kd polypeptides in cells infected with the Japanese LAVV strain. Analysis of 10 strains derived from six different US sites and from 10 unrelated isolates obtained from Osaka, Japan, revealed that the lack of reactivity extended to all Japanese strains but not to any American strains examined. The antibodies also failed to react with virus particles purified from LAVV-infected cells; since there appeared to be no difference in the polypeptide profiles of American and Japanese virus particle polypeptides in the 47-kd size range, it was concluded that lack of reactivity with the antibodies was the result of amino-acid sequence variations and not due to lack of synthesis of the ORF 10 protein by Japanese strains. The Nterminal portion of ORF 10 was therefore sequenced from several representative Japanese and American VZV strains.

The Figure 1 summarizes the sequence information obtained. The sequences were derived from polymerase chain reaction (PCR)-amplified DNA of the Nterminal region of ORF 10, using the primers TAGTACCACGTGGTATTATGAAC (N10F; corresponding to 12,041 to 12,063) and AAGGCGGAGACGGAGCAGTTTTA (N10R; corresponding to the complement of 12,311 to 12,332). The 290-bp amplified fragment was cloned using a TA Cloning Kit (In Vitrogen Corp.) and sequenced using a PCR-based DNA Sequitherm Kit (US Biochemical, Inc.). The DNA sequencing showed that all Japanese strains analyzed possessed a single base-pair change (C to A) at position 12,188, which is different from the published DNA sequence of Dumas and all American strains examined. The change resulted in a proline (found in the Dumas sequence) to histidine substitution at the 10th amino acid of ORF 10, which presumably caused the lack of reactivity with the anti-10 peptide antibodies. Further sequencing also revealed changes at positions 12,283 and 12,284 (both T-to-C changes) found in the Japanese strains examined, which caused a change of phenylalanine (in the Dumas strain) to serine at the 42nd amino acid of ORF 10 and the creation of a novel BamHI site. Interestingly, BamHI is one of the restriction enzymes used to differentiate LAVV from wild-type strains. However, these changes did not appear to be as tightly restricted, since they were found in three strains of American origin.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1. Diagrammatic representation of DNA sequencing of the N-terminal part of open reading frame (ORF) 10 and the variations found within a 290-base-pair fragment. (a) The relative position and transcriptional direction of ORF 10 is shown with respect to the VZV genome. A line represents the unique sequences, and bars represent the internal and terminal repeat sequences. (b) An expansion of VZV ORF 10, showing the relative position of the oligonucleotides used for PCR amplification (N10F, N10R) and the coordinates of the variations detected. (c) Expansion of the sequence variations found in VZV strains, both at the DNA and amino-acid sequence level, with the virus strains listed below the respective variations contained within their genomes. Z equals zoster isolate; V equals varicella isolate; Am equals American origin; Jap equals Japanese origin; Eur equals European origin. Dumas is the sequenced strain of VZV. ^[4] All Japanese strains were obtained from M. Takahashi, Osaka, Japan, and have previously been shown to be unrelated. ^[7] American strains were obtained as follows: Hagar-a, Dyke-b equals Pittsburgh, PA, isolates; Blocker, LaRue, Chase equals gift of A. Arvin, Stanford, CA; 32 equals gift of C. Grose, Iowa City, IA; MSD equals gift of E. Dunkel, Harvard, MA; Scott equals Bethesda, MD, isolate; Ellen, Webster equals obtained from American Type Culture Collection.

These polymorphisms and their differentiation by anti-peptide antibodies should prove useful in epidemiologic assessment of the Japanese-derived LAVV in American-based clinical trials, as they could be used to recognize American wild-type virus infections or disease in LAVV vaccinees. We have recently examined 18 reisolated strains from LAVV vaccinees (kindly supplied by A.A. Gershon, Columbia University, New York, NY). Of these, two were found to express 47-kd polypeptides which react with the anti-ORF 10 peptide antibodies, and further examination revealed that these were both wild-type isolates from LAVV recipients. We are currently examining additional LAVV reisolates for these variations as well as wild-type markers to identify possible in vivo recombinants.