Adult-onset MLD: A gene mutation with isolated polyneuropathy

Case report.

A 22-year-old man developed acute left-hand weakness 2 weeks before our evaluation. There was no known antecedent injury and the his medical history was otherwise unremarkable. His parents were second cousins of Asian Indian background. Family history was remarkable for Erb’s palsy in a younger brother. The patient was a bright, athletic, and energetic young man who was employed as a financial analyst for a large company. The patient’s examination was remarkable for moderate weakness of left hypothenar and interosseous hand muscles, and sensory loss involving the left hand (digits 4 and 5). Results of the neurologic examination were otherwise normal. About 6 months after his first evaluation, he awoke one evening with similar numbness involving the right hand. One year following his initial evaluation, all symptoms had completely resolved.

Nerve conduction studies, performed during the initial evaluation (table) , showed evidence of a left ulnar mononeuropathy superimposed upon a diffuse, uniformly demyelinating, sensorimotor polyneuropathy. Electromyography (EMG) was remarkable for fibrillations and positive waves, and reduced recruitment of larger-amplitude motor unit action potentials limited to the left first dorsal interosseous, abductor digiti minimi, and flexor carpi ulnaris. Results of the following studies were normal or unremarkable: cranial MRI scan, CSF studies, serum chemistries, visual and brainstem evoked potentials, EEG, and mutation analyses for the Charcot–Marie–Tooth neuropathies 1A, 1B, and X1. The Wechsler Adult Intelligence Scale III testing revealed a full scale IQ score of 124, verbal score of 128, and performance score of 114.

Epon-embedded sections of sural nerve, 1-μm thick, revealed a mild reduction in myelinated fibers, many thinly myelinated fibers, and Schwann cell inclusions (figure 1) . Onion bulb formations were rare and regenerating axon clusters were absent. Ultrastructural studies revealed prismatic Schwann cell inclusions with periodicity of 5.6 to 5.8 nm (see figure 1). Morphometric data revealed the following values: myelinated fiber density, 3,966/mm² (normal, 6,906 ± 329/mm²); mean fiber area, 26.7 μm² (based on 333 fibers) (normal, 37.8 ± 1.9 μm²); and mean g-ratio, 0.78 (based on 200 fibers) (normal, 0.65).

• Download figure
• Open in new tab
• Download powerpoint

Figure 1. Sural nerve histopathology. (A and B) Semithin transverse (×400 before reduction) and longitudinal (×1000 before reduction) sections stained with toluidine blue show a mild reduction in myelinated fibers, many thinly myelinated fibers, and Schwann cell inclusions (arrows). (C) Electron microscopy demonstrates prismatic inclusions within a Schwann cell (×39,000 before reduction). (D) At higher magnification, these inclusions show a periodicity of 5.6 to 5.8 nm (×73,000 before reduction).

Methods.

Enzyme activity for ASA was determined in leukocytes and cultured skin fibroblasts. The K_m and V_max for fibroblast ASA activity were determined using nitrocatchol sulfate as substrate, using assay conditions as previously described,1 with the substrate concentration ranging from 0.2 to 8 mM.

DNA was extracted from peripheral blood leukocytes using the Puregene extraction kit (GENTRA Systems, Minneapolis, MN). Briefly, erythrocytes were first lysed and removed by centrifugation. The remaining cell pellet was then resuspended in cell lysis solution. Subsequent to protein precipitation, the supernatant was removed to a clean microcentrifuge tube containing 300 μL 100% isopropanol to precipitate DNA. DNA hydration solution was then added and the sample allowed to rehydrate overnight at room temperature or at 65 °C for 1 hour. DNA concentrations were determined by absorbance spectrophotometry. Screening of mutations 459 + 1 G—A (allele I) and C2381T (allele A) of the ASA gene was performed essentially as described,2 in individual amplification reactions with endonucleases Xba I and Pst. Screening of mutation T799G was performed as described by Gomez Lira et al.3 Genomic DNA was amplified by restriction site generating PCR (RG-PCR),4 using a modified F primer 5′TGACCAGGGCCTGGTCCCGA3′ in exon 3, which creates a restriction site for Sau IIIA1. The amplified product was digested for 3 hours and then analyzed by 12% acrylamide electrophoresis. The eight exons and exon–intron boundaries of the ASA gene were amplified as previously described.5 We performed heteroduplex analysis on the amplified products by standard procedures, mixing amplified fragments of the patient with amplified control fragments to create heteroduplexes. Direct sequencing of all eight exons and exon–intron boundaries was performed using an automatic ABI 377 PRISM DNA Sequencer (Applied Biosystems, Foster City, CA). Genomic DNA was amplified and then digested with Bsa I for 3 hours at 50 °C. Digested products were analyzed by 15% acrylamide gel electrophoresis.

Results.

Arylsulfatase A activity was 6.8 nmol/mg protein/h from leukocytes (normal, 44 ± 11) and 172 nmol/mg protein/h from cultured fibroblasts (normal, 673 ± 408). Kinetic analyses for fibroblast ASA revealed a K_m value of 2.2 mM for normal control fibroblasts and 2.3 nM for the patient. The V_max value was 985 nmol/mg protein/h for the normal control pooled fibroblasts and 44 nmol/mg protein/h for the patient. The urinary sulfatide level was 0.58 nmol/mg creatinine (normal, 0.10 ± 0.05).

Direct sequencing of all amplified fragments demonstrated a homozygous transition, A1505C, in exon 5 (figure 2). The transition determines a substitution of threonine by proline at codon 286 (Thr286Pro) in the amino acid chain. The mutation lies near the primer F used to amplify exon 5. Because the mutation abolishes a Bsa I restriction site, it was possible to confirm the transition by restriction and electrophoresis of the digested products. Sequencing of exon 7 revealed that the patient was homozygous for a common polymorphism (Thr391Ser). The three most common MLD mutations (459 + 1 G—A, C2381T, and T799G) and the pseudodeficiency allele (Asn350Ser) in exon 6 were not detected. Sequencing of the entire coding sequence and exon–intron boundaries revealed no other sequence alteration.

• Download figure
• Open in new tab
• Download powerpoint

Figure 2. (A) Sequence analysis of the A1505C arylsulfatase A (ASA) gene mutation; amplified genomic DNA from the patient shows the point mutation (arrow). The sequence should be read from left to right. (B) Restriction analysis of the A1505C mutation in the ASA gene; 15% acrylamide gel electrophoresis of the PCR-amplified genomic DNA. The mutation abolishes a BsaI restriction site. A 411-bp fragment is restricted by the enzyme to fragments of 337, 45, and 29 bp in the normal allele. The mutant allele shows a 74-bp fragment due to the abolished restriction site. P = patient; MW = molecular weight marker (25 bp); C = control; nd = not digested amplified fragment.

Discussion.

Metachromatic leukodystrophy is an autosomal recessive disorder due to a deficiency of ASA, the lysosomal enzyme that converts cerebroside sulfatide, a major component of myelin, to cerebroside.6 The ASA gene, localized at 22q13.31-qter, contains eight exons along a 1.5-kb coding sequence and, thus far, over 60 mutations have been identified.7,8⇓ The reduced activity of the ASA enzyme leads to accumulation of sulfatides in Schwann cells and oligodendrocytes. It is speculated that the accumulating sulfatides cause neurologic dysfunction by rendering the molecular structure of myelin unstable, interfering with the function of Schwann cells and oligodendrocytes, or reducing the critical temperature needed for lipid bilayer stability.9

Based on age at onset and disease severity, three forms of MLD are recognized: late-infantile, juvenile, and adult.6,8⇓ Adult-onset MLD is the least common form; the initial symptoms usually include progressive intellectual decline, behavioral changes, and frank psychosis. The diagnosis of MLD is confirmed by demonstrating a deficiency of ASA activity in leukocytes or cultured skin fibroblasts, and increased urinary sulfatide levels. Supportive data include EMG evidence of a demyelinating sensorimotor polyneuropathy, cranial MRI evidence of a diffuse white matter disease, neuropsychologic testing evidence in support of a progressive dementia, and sural nerve histopathologic evidence of a demyelinating polyneuropathy with metachromatically stained granules and characteristic Schwann cell inclusions.6,9⇓

To our knowledge, this is the second reported case of MLD with isolated peripheral nervous system involvement.10 In contrast to the previous report, our patient’s polyneuropathy was subclinical and only discovered during the EMG workup for his left hand weakness. Recurrent mononeuropathies, as in our patient, have not been previously reported in MLD. It is possible that these were unrelated to MLD; however, given the absence of recognized ulnar nerve compression or trauma, a relationship seems plausible. Akin to the clinical findings in other neuropathies (e.g., hereditary neuropathy with liability to pressure palsies), we suspect that the MLD may have increased our patient’s liability to compressive ulnar mononeuropathies. The novel homozygous Thr286Pro missense mutation adds to the growing list of previously reported ASA gene mutations. The substitution of threonine by proline may have a major effect upon polypeptide structure and orientation because of the restrictions imposed by the proline ring and, therefore, is likely responsible for producing the mutant ASA enzyme.