An atypical intronic deletion widens the spectrum of mutations in hereditary spastic paraplegia

Genealogic and clinical assessment.

Informed consent was obtained before clinical and genetic testing. A detailed neurologic examination was performed on all study participants, including evaluation of the cranial nerves, deep tendon reflexes, motor, and sensory systems. Information on 116 individuals established the pedigree and the affection status of a seven-generation family with HSP (figure 1). The founder couple was born in the United States in the late 18th century. The Cyrillic 2.1.3 software program (Cherwell Scientific Publishing Ltd., Oxford, UK) was used to draw the pedigree and enter the haplotype data.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1. Pedigree of a family with spastic paraplegia. Black circles (females) and squares (males) represent affected individuals with spastic paraplegia. Three individuals (V-43, VI-26, and VI-30) with early clinical signs of the disorder are represented by cross-hatched symbols. Unaffected individuals are not shaded. Reconstructed haplotypes for the five chromosome 2p loci D2S146, D2S35, D2S367, D2S2230, and D2S177are shown below individuals. Individual VI-2, VI-10, V-46, and V-47 are recombinants at locus D2S146, and Individuals VI-20, VI-34, and VII-1 are recombinants at D2S177. For reasons of confidentiality, the order and sex of at-risk individuals are changed.

Genetic linkage analyses of candidate loci.

High-molecular-weight genomic DNA was isolated from whole-blood lysate by phenol-chloroform extraction with isopropanol precipitation. Polymorphic fluorescently labeled microsatellite loci linked to the SPG3, SPG4, SPG6, SPG8, and SPG10 loci were used to identify the disease locus.4-8⇓⇓⇓⇓ Fifty nanograms of genomic DNA was used in a PCR in a total volume of 15 μL with 0.8 μmmol/L of each primer, 1.5 mmol/L MgCl₂, 200 μmol/L dNTP, 50 mmol/L KCl, 10 mmol/L Tris HCl (pH = 8.3), 0.01% gelatin, and 0.5 units Taq DNA polymerase (Perkin Elmer-Cetus, Foster City, CA). Reactions were performed in a 96-well microtiter plate, and amplification was performed out for 30 cycles (45 seconds denaturation at 95 °C, 45 seconds annealing at 55 °C or 60 °C, and 45 seconds extension at 72 °C) on a Genius thermocycler (Techne Inc., Princeton, NJ). The last extension step was 7 minutes at 72 °C. Four microliters of the reaction mixture was electrophoresed on an EASIgel (6.0% acrylamide/0.3% bis-acrylamide [7 mol/L urea] (Scotlab, Strathclyde, Scotland]). The PCR products were visualized on an FMBIOII (Hitachi Software Engineering Co., Ltd., South San Francisco, CA) scanning unit. Genotypes were determined blind to the diagnosis. All of the assumptions regarding phenotype definition and genetic parameters (mode of inheritance, penetrance and frequency of the susceptibility allele) were made a priori without any information about the genetic marker phenotypes.

Pairwise linkage analyses were performed by using the MLINK program of the FASTLINK package (Version 4.0P).12-15⇓⇓⇓ The lod score calculations assumed an autosomal dominant mode of inheritance, no sex differences, and a mutant gene frequency of 1/10,000. Allele frequencies were set at 1/n, where n is equal to the number of published alleles for each locus (http://gdb.infobiogen.fr). The recombination fractions and the order of genetic markers were set as reported in the Marshfield Genetic Database (http://www.marshmed.org). A conservative “affecteds only” model was used to calculate the lod scores. An unknown status was assigned to all other individuals including Individuals V-43, VI-26, and VI-30 (figure 1) with an uncertain diagnosis.

SSCP and mutational analysis.

PCR amplifications were performed on individual family members using genomic DNA and primer sequences flanking all 17 exons of the SPAST gene. An initial, standard 10-μL PCR reaction was performed on genomic DNA with primers for a given exon. One microliter of this reaction was then used in a new 10-μL PCR reaction containing 8 microCuries/μL of α-³²P dCTP (NEN, Boston MA; 10 microCuries/μL, 3,000 Ci/mmol/L) and 12.5 μmol/L dCTP. Single-strand conformation (SSCP) analysis was performed on the samples as follows: 120 μL of gel loading dye containing 54% formamide, 10 mmol/L ethylenediaminetetra-acetic acid (EDTA), and dyes (0.025% xylene cyanol and 0.025% bromophenol blue)16 was added to each PCR reaction. The reactions were heat denatured for 5 minutes at 95 °C, and quenched on ice before loading on a 30 × 40-cm MDE gel (FMC, Rockland, ME). Electrophoresis was performed at 6 to 8 Watts for 14 to 16 hours at room temperature. The gel was transferred to filter paper and dried, and exposed to x-ray film with an intensifying screen (Reflection; NEN, Boston MA) at room temperature until a suitable exposure was obtained (typically, 3 hours). PCR fragments with mobility shifts that segregated with the disease were ligated to the vector pCR2.1 by using a TA cloning kit (Invitrogen Co., Carlsbad, CA). The vector and insert were transfected into INVaF' competent Escherichia coli cells (Invitrogen) and plated on Luria Broth agar containing ampicillin (50 μg/mL) and X-gal (20 mg/mL in dimethylformamide) to test for α-complementation. Approximately 50 white colonies were chosen, and DNA was extracted by alkaline mini-prep.17 The first 20 colonies were sequenced by using an ABI 373 sequencer.

Clinical features.

Detailed neurologic examinations were performed on 35 individuals (figure 1). The mean age at examination of the 21 unaffected individuals (57 ± 18, 20–86; mean age, range) was similar to the 11 affected individuals (56 ± 13, 36–80). Five women and six men were affected by lower extremity hyperreflexia and a spastic gait. No differences were found between the sexes in the age of onset (41 ± 13, 20–60) or the disease duration (16 ± 6, 6–24). The initial symptoms were stiffness in the lower extremities in men and weakness or sensory loss in the lower extremities in women. All affected women had some degree of weakness of hip flexion, extension, abduction, or adduction. The diagnosis was suspected in three individuals (figure 1; V-43, VI-26, and VI-30). Individual V-43, age 70, began having difficulty walking at age 60 because of proximal muscle weakness in her lower extremities. She had proprioceptive loss at the lateral malleolus with proximal muscle weakness of the lower extremity. Spasticity and hyperreflexia were absent. Individual VI-26, age 39, was asymptomatic except for hyperreflexia, and increased tone at the heel cords. Individual VI-30, age 38, had a left foot drop for 1 year. Her left knee and ankle deep tendon reflexes were brisk, but the left plantar response was mute. She exhibited weakness of plantar flexion and dorsiflexion, and ankle inversion and eversion.

Identification of the SPG4 locus.

Exclusionary lod scores less than −2.0 were obtained at loci in the SPG3, SPG6, SPG8, and SPG10 regions. Five loci (D2S146-2.4 cM-D2S352-3.3 cM-D2S367-2.8 cM-D2S2230-1.5 cM-D2S177) defined the SPG4 interval with a maximum lod score of 4.26 for locus D2S367 (table). Haplotype analysis (figure 1) showed recombination at locus D2S177 in Individual VI-34. Although phase could not be established, a historic recombination at locus D2S146 is present in Individuals VI-2, VI-10, and VII-1. Multipoint analysis (data not shown) further narrowed the candidate region to a 6.1 cM interval between D2S352 and D2S2230. This region is identical to the SPG4 interval known to contain the SPAST gene.9

SPAST mutation detection.

SSCP analysis of SPAST exon 3 and its flanking intronic sequences identified a distinct mobility shift that segregated with the disease haplotype (figure 2). This pattern was not found when the other 16 exons of the SPASTgene were analyzed. The exon 3 mobility shift was present in the 11 affected individuals and in the three individuals suspected of having the disorder but not in the 21 unaffected family members. The PCR product was inserted into a vector, and the sequence of the 20 clones was examined. The sequence of 9 of 20 clones was identical to sequence with BAC 336P14 (http://www.genoscope.cns.fr). Eleven of the 20 clones showed a four-base-pair intronic deletion (delTAAT) located nine bases from the last codon of SPAST exon 3 (figure 3). The ratio of clones that contain delTAAT is close to the expected ratio of 50% for wild type and mutant sequences in a heterozygous state.

• Download figure
• Open in new tab
• Download powerpoint

Figure 2. Autoradiograph of mobility shifts on SSCP. Using oligonucleotide primers SPAST3F (5'-3') CTGTATAAAGACTGTGACTCC and SPAST3R (5'-3') CCACATTTTCAATCACTGATC, a 290 base pair fragment was analyzed by SSCP. Lanes 1-9 are affected individuals (figure 1, Individuals VI-2, V-24, VI-24, VI-30, VI-31, VI-34, V-45, V-23, and V-20). Lanes 10 and 11 are normal individuals from the CEPH panel (1331-01, 1344-02). Lanes 12 and 13 are unrelated spouses (figure 1, Individuals V-22 and V-15). All affected individuals have two doublets representing an allele with the delTAAT.

• Download figure
• Open in new tab
• Download powerpoint

Figure 3. Partial genomic structure of the SPAST gene showing a four-base-pair deletion in intron 3. The black block is the 3' end of exon 3. The open block represents the intervening sequence between exons 3 and 4 (IVS-3) called intron 3. The four base pair intronic deletion that causes hereditary spastic paraplegia in our family is boxed. The sequence corresponds to nucleotides 35825 to 35849 in GenBank (accession number AJ246003).