Abstract
Background: Congenital muscular dystrophies (CMD) are autosomal recessive disorders that present within the first 6 months of life with hypotonia and a dystrophic muscle biopsy. CNS involvement is present in some forms. The fukutin-related protein gene (FKRP) is mutated in a severe form of CMD (MDC1C) and a milder limb girdle dystrophy (LGMD2I). Both forms have secondary deficiencies of laminin α2 and α-dystroglycan immunostaining. Structural brain involvement has not been observed in patients with FKRP gene mutations.
Methods: The authors studied two unrelated patients who had a pattern of muscle involvement identical to MDC1C, mental retardation, and cerebellar cysts on cranial MRI. The FKRP gene was analyzed along with the skeletal muscle expression of laminin α2 and α-dystroglycan.
Results: The muscle biopsy of both patients showed severe dystrophic findings, a reduction in laminin α2, and profound depletion of α-dystroglycan. Both patients had homozygous FKRP gene mutations not previously reported (C663A [Ser221Arg] and C981A [Pro315Thr]).
Conclusions: Mutations within the FKRP gene can result in CMD associated with mental retardation and cerebellar cysts. This adds structural brain defects to the already wide spectrum of abnormalities caused by FKRP mutations. The severe depletion of α-dystroglycan expression suggests that FKRP is involved in the processing of α-dystroglycan.
Congenital muscular dystrophies (CMD) are a heterogeneous group of autosomal recessive disorders characterized by hypotonia, muscle weakness, and joint contractures that present at birth or during the first 6 months of life and have dystrophic changes on skeletal muscle biopsy.1 Mental retardation with or without structural CNS changes may accompany some forms. Based on the clinical, immunohistochemical, and genetic findings, eight different forms have been characterized genetically, and additional forms have been identified clinically.2
Many CMD patients have a primary deficiency of the laminin α2 chain of merosin, resulting from mutations in the LAMA2 gene.3,4⇓ This form is commonly referred to as “merosin-negative” CMD, or MDC1A, for muscular dystrophy congenital type 1A. In the remaining “merosin-positive” forms, mutations in SEPN1 have been identified in patients with spinal rigidity and restrictive respiratory syndrome (RSMD1, for rigid spine muscular dystrophy 1),5,6⇓ COLVI in the Ullrich CMD variant caused by collagen VI deficiency,7 and ITGA7 in integrin α7 deficiency.8 The genes of two CMD forms presenting with structural brain involvement and a secondary partial deficiency of laminin α2 have also been identified: Fukuyama CMD (FCMD), caused by mutations in fukutin,9 and muscle eye brain disease (MEB), resulting from mutations in POMGnT1.10,11⇓ Another CMD form characterized by muscle hypertrophy and partial secondary laminin α2 deficiency has been mapped to 1q42 (MDC1B, for muscular dystrophy congenital 1B), but its gene remains elusive.12 Therefore, several CMD forms with or without mental retardation and structural brain involvement13-18⇓⇓⇓⇓⇓ appear to have in common a secondary deficiency of laminin α2, suggesting that the disruption between the basal lamina elements and the dystrophin-associated glycoprotein complex is commonly involved in pathogenesis of CMD.
A novel fukutin homologue, the fukutin-related protein gene (FKRP), was found to be mutated in a form of CMD with onset in the first weeks of life and a severe phenotype with inability to walk, muscle hypertrophy, marked elevation of serum creatine kinase, normal brain structure and function, secondary deficiency of laminin α2, and a marked reduction in α-dystroglycan expression.19 This form has been termed MDC1C (muscular dystrophy congenital type 1C). Moreover, we also identified mutations in the same gene in a form of limb girdle muscular dystrophy (LGMD2I) characterized by later onset and a relatively benign course.20 Therefore, the clinical spectrum of FKRP mutations ranges from MDC1C with the inability to walk to a much milder LGMD2I phenotype. To date, mental retardation or structural brain changes have not been detected in any patient with an FKRP mutation.
Although the function of fukutin or FKRP is not known yet, both have sequence similarities to a family of proteins involved in modifying cell-surface molecules such as glycoproteins and glycolipids.21 Members of this family contain a strictly conserved D × D motif found in many glycosyltransferases,22 and it has been suggested that fukutin and FKRP may be involved in the glycosylation of α-dystroglycan.19 A marked reduction in α-dystroglycan expression, significantly more prominent than the accompanying laminin α2 deficiency, has been detected in patients with mutations in the genes for FKRP and fukutin.19,20,23⇓⇓ Similar findings have also been observed in MEB24 and the myd mouse, a mouse model of muscular dystrophy resulting from a mutation in yet another glycosyltransferase, LARGE.25 All four diseases share the common feature of a defect in either a known or putative glycosyltransferase and abnormal processing of α-dystroglycan. Whether these enzymes have a direct or indirect role in the glycosylation of α-dystroglycan is presently unknown.
In this study we have characterized two unrelated patients with a severe form of CMD with similar pattern of muscle involvement as the one observed in MDC1C. Both patients also had mental retardation and cerebellar cysts. Both patients had a secondary deficiency in laminin α2 and marked depletion of α-dystroglycan immunostaining on skeletal muscle biopsy. Novel mutations in the FKRP gene were identified in both patients, expanding the already wide clinical spectrum arising from mutations within this gene.
Methods and patients.
Patient 1.
A clinical description of this patient has been previously reported.17 The proband had a form of CMD characterized by severe weakness, mental retardation, cerebellar cysts, and secondary laminin α2 deficiency. She was the first child of consanguineous parents and had a healthy brother. After an uneventful pregnancy and normal labor, she was examined for weakness at age 3 months. She could sit with support at age 7 months. On initial admission at age 1.5 years, she was hypotonic, had diffuse muscle weakness, and was able to sit only. She had myopathic face and high arched palate. Head circumference was between the 25th and 50th centile (49 cm at 3 years). Serum creatine kinase (CK) level was 4515 IU/L, and electromyogram (EMG) showed myopathy. Results of a muscle biopsy showed dystrophy with severe fibrosis, adiposis, and variation in fiber size with few necrotic fibers. She was never able to stand or walk. She had mild mental retardation with an IQ of 59 by Stanford–Binet scale at age 6 years. Cranial MRI showed multiple small cysts in cerebellar cortical and subcortical areas, without cortical dysplasia or white matter changes at age 6 years. Ophthalmologic examination was normal. Muscle biopsy was repeated at age 6 years, and results showed an increase in severity of dystrophic changes. Spectrin, dystrophin, α-sarcoglycan, and β-dystroglycan were normal, whereas laminin α2 was severely reduced and laminin α5 was unregulated. Clinical course was slowly progressive. At age 9 years, she had increased lordosis, scoliosis, and rigidity of the spine. Weakness of head and neck muscles was especially prominent. Serum CK level was 2662 IU/L. Genetic analysis for the LAMA2, FCMD, and MEB loci showed that she was heterozygous for all informative markers in the three critical genomic regions. As a result, this form was considered to represent a novel entity.17
Patient 2.
This patient was an 18-month-old boy. Reduced intrauterine movements were reported during pregnancy. He was weak and hypotonic from birth and was only able to sit at 14 months. On initial examination at age 18 months, he had contractures and a myopathic face. There was no muscle hypertrophy. Head circumference was 48 cm (between the 25th and 50th centile); serum CK level was 863 IU/L (normal <190); and EMG showed myopathy. Results of a muscle biopsy from the quadriceps showed severe dystrophic features with prominent endomysial and perimysial fibrosis, moderate fatty infiltration, and necrosis. He was never able to walk. At age 4.5 years, he was able to sit unsupported but could not stand. There were contractures at the elbows, hips, and knees. Serum CK level was 6587 IU/L. Muscle biopsy was repeated, and immunohistochemical analysis showed normal labeling for spectrin, dystrophin, and α-sarcoglycan. Laminin α2 was reduced. When last seen at age 10 years, he had a history of frequent respiratory infections. His IQ was 63. He had a long and elongated face with facial weakness. Contractures were the same; however, mild hypertrophy of the lower limbs could be noticed (figure 1). He was also weaker to the extent that he could not feed himself because of the involvement of his arm muscles. Serum CK level was 1515 U/L. Cranial MRI at age 10 years revealed bilateral parietal cystic white matter areas, cortical atrophy, preservation of subcortical U fibers, and multiple cysts in both cerebellar hemispheres (figure 2). Linkage analysis to known CMD loci could not be performed.
Figure 1. Patient 2 at age 10 years. Sits without support, myopathic face, multiple contractures, extremely hypotonic, and mild hypertrophy of the calves.
Figure 2. Cranial MRI of Patient 2 at age 10 years. T2-weighted coronal (A) and T1-weighted inversion recovery coronal (B) images showing large cystic areas in both parietal white matter, cortical atrophy, and bilateral multiple cerebellar cysts.
Methods.
Immunohistochemical analysis.
Monoclonal antibodies to spectrin, dystrophin, α-, β-, γ-, δ-sarcoglycan, β-dystroglycan, laminin α2 (Novocastra, Newcastle upon Tyne, UK), and α-dystroglycan (V1A4–1, Upstate Biotechnology, Lake Placid, NY) were used. For α-dystroglycan, 8-μm frozen sections were fixed in ice-cold acetone for 5 minutes, washed with phosphate buffer solution (PBS), blocked with 8% bovine serum albumin (BSA)/PBS for 30 minutes, and then incubated with primary antibody (1:100) in 1% BSA/PBS overnight at 4 °C. For all other antibodies, sections were incubated with the primary antibody for 1 hour. After washing with PBS, all sections were incubated with biotin-conjugated secondary antibody (Amersham, Arlington Heights, IL; 1:200) for 45 minutes, washed with PBS, and incubated with Texas Red conjugated streptavidin (Amersham, 1:100) for 30 minutes. Slides were rinsed with PBS, mounted, and observed with a Zeiss Axioplan fluorescence microscope (Zeiss, Oberkochen, Germany).
Genetic analysis.
Mutation analysis was performed by amplifying a 1.7-kb fragment of genomic DNA containing the entire FKRP coding sequence using Advantage-GC Genomic Polymerase Mix (Clontech, Palo Alto, CA) and primers FKRP-1F (AAAGGGAATTGAGAAAGAGC) and FKRP-5 (GCTCACACAGAGCTTCTCC). PCR products were separated by agarose gel electrophoresis, purified (Qiagen, West Sussex, UK), and used for direct sequencing. Sequencing reactions were carried out using an ABI Prism BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Weiterstadt, Germany) and primers FKRP-1R (GCAGGAAGGAGTCTACCAG), FKRP-2R (CCGAGAGGTTGAAGAGGT), FKRP-3R (CTCCTCGTAGAGGTAGGC), FKRP-4R, and FKRP-5R. Sequencing products were separated on an ABI377 automated sequencer (Applied Biosystems) and analyzed using SeqEd (Applied Biosystems).
Linkage to the FKRP locus was determined using flanking markers D19S219 and D19S606. The order of markers is centromere-D19S219-FKRP-D19S606-telomere.
Results.
Immunohistochemistry.
Because there was a limited amount of tissue left from Patient 1, only spectrin, laminin α2, β-dystroglycan, and α-dystroglycan antibodies were used. Laminin α2 expression was reduced, whereas α-dystroglycan was virtually absent in all fibers (figure 3). β-Dystroglycan labeling was normal. The whole panel of antibodies was applied to Patient 2. There was moderate deficiency of laminin α2 around muscle fibers, whereas its expression was normal in peripheral nerves. α-Dystroglycan labeling was virtually negative (see figure 3). Expression of β-dystroglycan and all other antibodies was normal.
Figure 3. Immunocytochemical analysis of spectrin (A–C), laminin α2 (D–F), and α-dystroglycan (G–I) in control skeletal muscle, Patient 1, and Patient 2. α-Dystroglycan expression is virtually negative, and laminin α2 expression is reduced in both patients. Laminin α2 expression is normal in the peripheral nerve of Patient 2.
Mutation analysis of the FKRP gene.
The entire FKRP coding region was sequenced in both patients. Two novel homozygous missense mutations were identified. These were at C981A (Pro315Thr) in Patient 1 and C663A (Ser221Arg) in Patient 2 (figure 4). These mutations were not identified in 100 control volunteers.
Figure 4. DNA sequence-electrophoretogram and identification of homozygous FKRP mutations in Patients 1 and 2.
Discussion.
In this study, we provide further evidence that mutations in the FKRP gene cause a severe CMD form. The severity of myopathy in the children reported in this article is similar to those reported in the original description of MDC1C: inability to walk, marked elevation of serum CK level, and secondary deficiency of laminin α2 with marked depletion of α-dystroglycan.19 In striking contrast with MDC1C, however, the two affected children reported here also had mental retardation and cerebellar cysts, a feature not present in any previously reported patients with FKRP gene mutations. These further expand the unusually wide spectrum of disease severity associated with FKRP mutations to now include structural brain changes. Cerebellar cysts, mental retardation, and secondary laminin α2 deficiency can be seen in FCMD and MEB, where it is an accompanying feature of other brain malformations.13,14⇓ In both patients reported here, α-dystroglycan expression was virtually absent, whereas β-dystroglycan, post-translationally derived from the same gene, was normal. It is of interest that although laminin α2 expression was reduced in muscle fibers of both patients, Patient 2 had normal laminin α2 expression in nerves. A consistent finding in all patients with FKRP mutations, in common with MEB and FCMD, is that α-dystroglycan expression is more markedly reduced than laminin α2, suggesting that it may be a more sensitive marker in patients with these disorders.19,20,23,24⇓⇓⇓
The two FKRP mutations reported in the current study have not previously been reported. It is unclear why these mutations give rise to a phenotype that includes CNS involvement because they are located in areas of the protein where other mutations have been observed.19,20⇓ However, the other patients we reported with mutations in this region were compound heterozygotes, i.e., carrying another missense mutation in the second allele.19,20⇓ Therefore, the homozygous state for these particular mutations in the two patients with structural brain involvement could be of importance.
FKRP appears to be ubiquitously expressed. Like most Golgi resident glycosyltransferases, protein sequence analysis predicts FKRP to have a short cytoplasmic N terminal fragment, a type II membrane-spanning region, a stem region, and a C terminal catalytic domain. Both mutations described here are likely to be located outside the catalytic domain, in the stem region. This region is believed to be involved in protein–protein interactions, and it is possible that these mutations may disrupt interactions that are specific to the brain.
The function of FKRP is unknown. However, there is strong evidence to suggest that this is a glycosyltransferase involved in glycosylation of α-dystroglycan. Not only is this protein severely reduced at sarcolemma with an antibody raised against an epitope that is believed to be glycosylated, but also the molecular weight of α-dystroglycan on Western blot analysis is abnormal in MDC1C, suggesting the loss of its higher molecular weight glycoforms.19 It is conceivable that this abnormal glycosylation affects the function of α-dystroglycan in muscle and, in particular, its laminin-binding properties that depend on the recognition of sugar residues.26,27⇓ Overall, our results suggest that mutations in the FKRP gene should be considered in patients with CMD associated with CNS involvement.
Acknowledgments
Supported by Muscular Dystrophy Campaign grant (to F.M.), the European Community grant (QLG1 CT 1999 00870) Myo-Cluster GENRE (Genetic Resolution of Congenital Muscular Dystrophy), and the Wellcome grant (to D.J.B.). D.J.B. is a Wellcome Trust Senior Fellow.
- Received May 23, 2002.
- Accepted November 15, 2002.
References
Letters: Rapid online correspondence
REQUIREMENTS
If you are uploading a letter concerning an article:
You must have updated your disclosures within six months: http://submit.neurology.org
Your co-authors must send a completed Publishing Agreement Form to Neurology Staff (not necessary for the lead/corresponding author as the form below will suffice) before you upload your comment.
If you are responding to a comment that was written about an article you originally authored:
You (and co-authors) do not need to fill out forms or check disclosures as author forms are still valid
and apply to letter.
Submission specifications:
- Submissions must be < 200 words with < 5 references. Reference 1 must be the article on which you are commenting.
- Submissions should not have more than 5 authors. (Exception: original author replies can include all original authors of the article)
- Submit only on articles published within 6 months of issue date.
- Do not be redundant. Read any comments already posted on the article prior to submission.
- Submitted comments are subject to editing and editor review prior to posting.
You May Also be Interested in
Use of Whole-Genome Sequencing for Mitochondrial Disease Diagnosis
Dr. Robert Pitceathly and Dr. William Macken