POLG mutations causing ophthalmoplegia, sensorimotor polyneuropathy, ataxia, and deafness

Case reports.

The first index case (III8 in figure 1), a 48-year-old man, had slowly progressive weakness of the lower limbs since aged 18 years. Around age 20 years, he developed difficulties initiating urination and erectile dysfunction. At age 35 years, he started having problems walking, with paresthesia and numbness in the legs. A few years later, he developed bilateral ptosis and progressive ophthalmoplegia. He also had a 30-year history of progressive hearing loss.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1. Family pedigree. Affected individuals are indicated by solid symbols. Gray symbols indicate subjects with migraine. Black triangles indicate subjects with psychiatric disorders. Asymptomatic individuals are indicated by open symbols. Arrows indicate the two index cases. Slashed symbols indicate deceased subjects.

Neurologic examination showed mild dysarthria, bilateral ptosis, complete ophthalmoplegia, mild weakness affecting predominantly distal muscles, and pseudoathetoid movements in both feet and in the right hand. Sensory examination revealed decreased touch and pinprick sensation in all four limbs; temperature and vibratory sensation and joint position sensation were absent in the legs. Deep tendon reflexes were absent, and Romberg sign was present. He had an ataxic gait. Funduscopic examination was normal. Neuropsychological evaluation revealed multiple cognitive deficits, global mental deterioration, and a depressed mood.

Blood chemistry values, including creatine kinase (CK) and basal lactate, were normal. Electrophysiologic investigations showed signs of severe peripheral axonal sensorimotor polyneuropathy. Magnetic stimulation showed slightly increased peripheral latencies and markedly decreased amplitudes of compound motor action potentials (CMAPs) with normal central conduction time. Visual evoked potentials (VEP) and electroretinography (ERG) were normal. EKG showed a complete right branch block. EEG showed nonspecific generalized slowing. Brain MRI showed slight atrophy of the brainstem. Muscle biopsy showed numerous cytochrome c oxidase (COX)-negative ragged-red fibers (RRF) and COX-negative non-RRF. Sural nerve biopsy showed marked decrease of large and small myelinated fibers, axonal degeneration, fibrosis, and no evidence of regeneration.

The second index case, a 33-year-old woman, was a sister of patient V8 (III12 in figure 1). She also had a neurologic syndrome, which started in her early 20s and was characterized by exercise intolerance, gait disturbance, paresthesia in the legs, bilateral ptosis, and PEO. Her neurologic examination resembled that of her brother. Routine laboratory tests, including serum CK and basal lactate, were normal. Electrophysiologic studies showed severe peripheral axonal sensorimotor polyneuropathy. MS showed signs of peripheral nerve involvement (slightly increased latency and decreased amplitude of the CMAPs). VEP and ERG examinations were normal. Brain CT was normal. The muscle biopsy did not show RRF and was reported as normal. Sural nerve biopsy showed severe loss of myelinated fibers without signs of nerve regeneration.

Family history revealed migraine and psychiatric disorders (depression and bipolar disorder) in multiple paternal and maternal relatives (see figure 1).

Methods.

Because muscle tissue was not available from the proband or his sister, we extracted total DNA from blood by standard methods. The entire coding regions for the POLG, ANT1, and Twinkle genes were amplified and sequenced as reported.4

PCR/restriction fragment-length polymorphism (RFLP) was used to confirm the mutations. For the C2794T mutation, we used a forward-5′ mismatch primer AGAGCAGGGGCACTGATGTA and reverse-5′ TAAAGCAGGCCTCGGGTCCT. PCR conditions for PCR/RFLP analysis were 94 °C for 5 minutes, followed by 35 cycles of 94 °C for 1 minute, 60 °C for 1 minute, 72 °C for 1 minute, and a final extension step at 72 °C for 7 minutes. The AccI restriction enzyme cut only the mutant DNA. For the G3151C mutation, we used a forward-5′ GCTTTGAGATGCTGAAAGAC and reverse-5′ TTTCTGACTCTGTGCCGCG with the same PCR conditions as above, except an annealing temperature of 55 °C. The BSTUI restriction enzyme cut only the mutant DNA.

Results.

Screening of ANT1 and Twinkle genes did not detect the presence of any mutation, whereas direct sequencing of the POLG gene revealed two compound heterozygous mutations in the proband (III8) and his sister (III12): C2794T in exon 18, changing a histidine to a tyrosine at position 932 (figure 2A), and G3151C in exon 20, changing a glycine to an arginine at position 1051 (figure 2B). Neither mutation was found in 120 control alleles. RFLP analysis confirmed the presence of each heterozygous mutation (figure 2, C and D), whereas in the other members of the family each mutation was present in isolation, although the two mutations were never seen together (see figure 1).

• Download figure
• Open in new tab
• Download powerpoint

Figure 2. Electropherogram and restriction fragment-length polymorphism (RFLP) analysis of the mutations in the proband (III-8) (A through C). The RFLP analysis in (D) includes the proband (III-8) and his sister (III-12). (A) Heterozygous mutation C2794T in exon 18 (arrow). (B) Heterozygous mutation G3151C in exon 20 (arrow). (C) The restriction endonuclease AccI cuts the 262 base pair (bp) mutant DNA fragment into two fragments of 243 bp and 19 bp (the smaller fragment is not shown). (D) The restriction endonuclease BSTUI cuts the 117 bp mutated DNA into two fragments of 98 bp and 19 bp.

Discussion.

Mutations in three nuclear genes—ANT1, Twinkle, and POLG—have been associated with adPEO.1–9⇓⇓⇓⇓⇓⇓⇓⇓ Mutations in the alpha subunit of polymerase gamma, the product of the POLG gene, cause multiple mtDNA deletions in muscle from patients with the chromosome 15-linked form of PEO.5 Polymerase gamma is a heterodimer composed of a 140-kDa alpha subunit and a 41-kDa beta subunit.5 It is part of a multienzymatic complex located within the inner mitochondrial membrane and required for mtDNA replication.5 The alpha subunit is catalytic and contains polymerase and exonuclease activities, whereas the beta subunit facilitates DNA binding and promotes DNA synthesis.5

The family described here had arPEO, multisystemic involvement, and two novel missense mutations in the POLG gene. Although we could not document multiple mtDNA deletions in skeletal muscle, we consider these mutations pathogenic for several reasons. First, they are consistent with the clinical presentation. Second, both mutated amino acids (Hys932 and Gly1051) are highly conserved throughout evolution and are in the polymerase region of polymerase gammaA, either within or close to the three polymerase motifs (pol A, B, and C) common to all DNA polymerases.5 Third, these mutations were not seen in 120 control subjects.

Most reported mutations in POLG affect either exonuclease or polymerase domains.2,4,5⇓⇓ It is generally assumed that mutations in the polymerase motifs cause disease only in homozygosity, whereas mutations in the exonuclease motifs are more deleterious to polymerase gamma function and cause disease even in heterozygosity. However, our family seems to contradict this concept. Both mutations were located in the polymerase motifs, but had low penetrance; the full phenotype was manifested only in the two homozygous individuals (III8, III12). Heterozygous individuals were either completely normal (II8, II20, III14, III17, III32, III34, IV4, and IV5) or oligosymptomatic without ptosis or ophthalmoplegia (II12, III9, III11, and III20).

Although mutations in ANT1 and Twinkle have been associated with dominant or sporadic cases of PEO,6–9⇓⇓⇓ mutations in POLG can cause either adPEO or arPEO.6–8⇓⇓ The clinical phenotypes of patients with POLG mutations are more heterogeneous and more severe than those of patients with ANT1 and Twinkle mutations.2–5⇓⇓⇓ For example, our patients showed—in addition to PEO—neuropathy, ataxia, migraine, hearing loss, and muscle weakness. The proband also had bladder and erectile dysfunction, symptoms not previously associated with POLG mutation. Although psychiatric symptoms have been reported in patients with mutations in all three genes (Twinkle, ANT1, or POLG),1,9⇓ the relationship between POLG mutations and psychiatric disorders is not clear in this family; the proband had depression, but his sister, who harbored the same mutations, did not, and other relatives with psychiatric disorders harbored only one mutation or none at all. Other genetic or environmental factors, besides POLG mutations, must contribute to the clinical phenotype of this family.

Defects of POLG are common causes of autosomal PEO and should be screened in familial PEO, especially in patients with multisystemic involvement.