Share

November 29, 2016; 87 (22) ArticleOpen Access

Gram-negative bacterial molecules associate with Alzheimer disease pathology

Xinhua Zhan, Boryana Stamova, Lee-Way Jin, Charles DeCarli, Brett Phinney, Frank R. Sharp
First published October 26, 2016, DOI: https://doi.org/10.1212/WNL.0000000000003391
Full PDF
Citation
Permissions

Make Comment

See Comments

Downloads
5786

Share

Abstract

Objective: We determined whether Gram-negative bacterial molecules are associated with Alzheimer disease (AD) neuropathology given that previous studies demonstrate Gram-negative Escherichia coli bacteria can form extracellular amyloid and Gram-negative bacteria have been reported as the predominant bacteria found in normal human brains.

Methods: Brain samples from gray and white matter were studied from patients with AD (n = 24) and age-matched controls (n = 18). Lipopolysaccharide (LPS) and E coli K99 pili protein were evaluated by Western blots and immunocytochemistry. Human brain samples were assessed for E coli DNA followed by DNA sequencing.

Results: LPS and E coli K99 were detected immunocytochemically in brain parenchyma and vessels in all AD and control brains. K99 levels measured using Western blots were greater in AD compared to control brains (p < 0.01) and K99 was localized to neuron-like cells in AD but not control brains. LPS levels were also greater in AD compared to control brain. LPS colocalized with Aβ1-40/42 in amyloid plaques and with Aβ1-40/42 around vessels in AD brains. DNA sequencing confirmed E coli DNA in human control and AD brains.

Conclusions: E coli K99 and LPS levels were greater in AD compared to control brains. LPS colocalized with Aβ1-40/42 in amyloid plaques and around vessels in AD brain. The data show that Gram-negative bacterial molecules are associated with AD neuropathology. They are consistent with our LPS-ischemia-hypoxia rat model that produces myelin aggregates that colocalize with Aβ and resemble amyloid-like plaques.

GLOSSARY

AD=
Alzheimer disease;
CERAD=
Consortium to Establish a Registry for Alzheimer’s Disease;
DAPI=
4',6-diamidino-2-phenylindole;
GM=
gray matter;
IL=
interleukin;
LPS=
lipopolysaccharide;
NSAID=
nonsteroidal anti-inflammatory drug;
WM=
white matter

Although age is the primary risk factor for the late-onset sporadic form of Alzheimer disease (AD), infection has also been implicated.1 Infection increases the odds of developing AD by 2-fold over 5 years.2 Diphtheria, tetanus, and pertussis; polio; tetanus; and influenza vaccines reduce the risk of subsequent AD.3,4 Inflammatory molecules including C-reactive protein and inerleukin-6 are elevated in blood years before dementia.5,6 Though clinical trials show that nonsteroidal anti-inflammatory drugs (NSAIDs) do not affect cognitive decline in AD,7 some studies suggest that NSAIDs decrease the risk of developing AD.8 Indeed, recent studies have demonstrated that sporadic late-onset AD is associated with infections.9,–,12 However, a consistent link between these agents and AD neuropathology has not been demonstrated.

Gram-negative bacteria like Escherichia coli can deposit amyloid.13,14 Moreover, we showed that administration of Gram-negative bacteria–derived lipopolysaccharide (LPS) followed by ischemia-hypoxia produce plaque-like aggregates of β-amyloid in rat brains.15 Though Gram-negative bacteria have been reported as the predominant bacteria found in normal human brains,16 the study did not describe pathologic correlates. Because of our finding that LPS promoted formation of amyloid-like plaques in rat brain,15 we determined whether Gram-negative bacterial molecules were associated with human AD neuropathology.

METHODS

Standard protocol approvals, registrations, and patient consents.

The institutional review board approved this study. Informed consent was obtained from all participants who were enrolled in studies at the University of California at Davis Alzheimer's Disease Center.

Brain samples.

AD was rated using Consortium to Establish a Registry for Alzheimer’s Disease (CERAD) criteria and Braak stage on 24 AD and 18 age-matched controls. Brain tissue was provided by the Alzheimer's Disease Center at the University of California Davis. Superior temporal gyrus gray matter (GM) was studied since it is commonly involved in AD and frontal lobe white matter (WM) was studied because it shows abnormalities in AD brains.17 Controls were age-matched individuals without cognitive deficits. Formalin-fixed brains used for immunostaining included 11 AD and 7 age-matched controls. Frozen brains used for Western blot analysis and PCR for E coli DNA included 13 AD and 11 age-matched controls.

Frozen tissue (∼1 cm3) from the superior temporal gyrus GM or frontal lobe WM was removed with sterile technique and frozen at −70°C. The tissue surface was treated with 75% ethanol and removed with a sterile scalpel blade. Frozen tissue was cored with autoclaved trephines and placed in sterile, endotoxin-free tubes at −70°C. Formalin-fixed (4%) brains were blocked, embedded in paraffin, and sectioned for immunostaining.

Immunofluorescence.

Detailed methods are described in our previous studies.15,17,18 Briefly, after removing paraffin with xylene and rehydrating through graded alcohols, sections were treated with antigen retrieval buffer and autofluorescence eliminator reagent (Millipore, Etobicoke, Canada). Primary antibodies were used in 1:200 concentrations unless stated otherwise. Secondary antibodies included either goat anti-mouse or goat anti-rabbit Alexa Fluor 488 or 594 (Invitrogen, Carlsbad, CA). Slide mounting medium included 4',6-diamidino-2-phenylindole (DAPI) to stain nuclei (Vector Laboratories, Burlingame, CA). For controls, primary antibody was deleted or immunodepleted with the target antigen of the antibody.

Western blot analysis.

Tissue was homogenized in cold RIPA buffer containing a protease inhibitor mixture. After centrifuging homogenates for 30 minutes at 4°C (14,000 g), the pellet was discarded and proteins in the supernatant separated on 10% sodium dodecyl sulfate polyacrylamide gels. They were then transferred to nitrocellulose membranes and hybridized overnight at 4°C with primary antibodies listed below. Antibodies were stained using horseradish peroxidase conjugated anti-rabbit or anti-mouse immunoglobulin G (Bio-Rad, Hercules, CA) combined with electrochemiluminescence detection (Piers). β-actin staining served as the control. We used NIH Image J software to quantify band intensities.

Primary antibodies were obtained from Abbiotec (San Diego, CA) (glial fibrillary acid protein, 250661; MAG, 250744), Abcam (Cambridge, UK) (E coli LPS, ab35654), Lifespan (Providence, RI) (E coli K99, LS-C83195), Millipore (Aβ1-40/42, AB5076; NeuN, ABN2300A4; NG2, AB5320), RayBiotech (Norcross, GA) (E coli LPS, MD-05-0148), Santa Cruz Biotechnology (Dallas, TX) (β-actin, sc-69879), ThermoFisher (Waltham, MA) (GSTπ, PA529601; Synapsin 2, OSS00020W), and Wako Chemicals (Cape Charles, VA) (Iba1, 019–19741).

PCR for DNA and DNA sequencing.

E coli DNA was detected using PCR amplification of an E coli glutamate decarboxylase B (gadB) DNA fragment.19 This DNA fragment was selected because it detects all E coli strains, and does not detect the human gene.19 All reagents used for PCR were first tested for E coli DNA contamination, which was indicated by detection of E coli DNA in endotoxin free water. Only those reagents that were free of E coli DNA were used for PCR amplification in human brains. Brain genomic DNA samples were isolated and purified using PureLink Genomic DNA Kits (K1820-01, Life Technologies, Carlsbad, CA). Approximately 20 mg of minced brain tissue from superior temporal gyrus was digested and DNA was eluted and frozen. E coli DNA from the ATCC 8739 strain (ATCC) was used as a positive control. PCR amplification was performed in a 50 μL reaction mixture, containing 10 ng of DNA, 25 μL of 2 × GoTaq Colorless Master Mix (Promega, Madison, WI), and 0.5 μM primer mix. The reaction mixtures were placed in a Gene Amp PCR System 9700 (Applied Biosystems, Foster City, CA) with the following settings: 5 minutes at 94°C, followed by 38 cycles of 40 seconds at 94°C, 45 seconds at 57°C, 30 seconds at 72°C, and a final extension time of 7 minutes at 72°C. Amplified products were analyzed in an Agilent (Santa Clara, CA) 2100 Bioanalyzer. Identification of the gadB gene was confirmed by a 3′ and 5′ Sanger DNA sequencing assay on 3 control and 3 AD samples at the UC Davis DNA Sequencing Facility. PCR products were sequenced with BigDye Terminator v 3.1 Cycle Sequencing Kit with Gel Company Better Buffer and postcycle sequencing purification was achieved at a Beckman Coulter (Sharon Hill, PA) Biomek NXp laboratory automation workstation with Beckman-Coulter CleanSEQ magnetic bead purification. Data were analyzed with ABI Prism (Applied Biosystems) 3730 genetic analyzer, ABI Prism 3730 data collection software v 3.0, and ABI Prism DNA sequencing analysis software v 5.2. DNA primers used in this study for PCR amplification and DNA sequencing were forward sequence (5′→3′) CACGTTTTGGTGCGAAGTCT and reverse sequence (5′→3′) TTGTGGACATTTTCGTCGTC (Eurofins MWG, Huntsville, AL). Amplicons were 175 bp with amplicon accession number M84025.1.19

Statistical analysis.

Differences between groups were analyzed using a Student t test (continuous), Wilcoxon–Mann-Whitney test (ordinal), or Fisher exact test (categorical). Differences between multiple groups were analyzed using one-way analysis of variance with Student-Newman-Keuls post hoc test. A p < 0.05 was considered significant.

RESULTS

Patient characteristics.

There were no significant differences in age or sex between patients with AD and controls (table e-1 at Neurology.org). The differences in median Braak and Braak stage20 and CERAD plaque scores between AD and control brains were significant (table e-1).

Detection of E coli K99 and Gram-negative bacterial LPS in AD and control brains.

Control samples (n = 10) and AD samples (n = 13) including GM (figure 1A) and WM (figure 1B) were assessed for E coli K99 pili protein.21 K99 was present in 9/13 AD GM compared to 1/10 control GM samples (p = 0.006) and in 10/13 AD WM compared to 4/10 control WM samples (p = 0.09). Quantification showed significantly greater amounts of E coli K99 protein in AD GM compared to controls and significantly more K99 in AD WM compared to controls (figure 1C).

Figure 1
Figure 1 Western blot analysis of Escherichia coli K99 pili protein and Gram-negative bacterial lipopolysaccharide (LPS) in human brains

(A) Western blot analysis of E coli K99 pili protein in gray matter (GM). E coli K99 was detected in 9 out of 13 Alzheimer disease (AD) cases and 1 out of 10 control (C) cases. (B) Western blot analysis of E coli K99 pili protein in white matter (WM). E coli K99 was detected in 10 out of 13 AD cases and 4 out of 10 control cases. (C) Quantification of E coli K99 protein. E coli K99 protein levels in AD brains were greater than in control aged brains in both GM (*p < 0.05) and WM (**p < 0.01). (D) Western blot analysis of Gram-negative bacterial LPS. A total of 3/3 AD GM, 3/3 AD WM, and 0/3 control GM showed LPS. Error bars are standard errors of the mean. β-actin was used as a loading control.

In addition, we used Western blots to test the specificity of Gram-negative LPS antibody, which was used for the immunocytochemistry studies described below. The LPS Western blots using the Abcam antibody (figure 1D, upper panel) showed a similar pattern of expression as that seen for the K99 Western blots (figure 1D, lower panel). LPS (Abcam antibody) was detected by Western blots in 3/3 AD GM, 3/3 AD WM, and 0/3 control GM (figure 1D). As a control, we repeated the Western blots of AD brain using another antibody to LPS (RayBiotech) as well as doing a blot after immunoprecipitating the antibody with LPS. The RayBiotech anti-LPS antibody detected a large band at 37 kD and a smaller band at 150 kD (figure e-1), whereas the LPS immunodepleted antibody showed the 150 kD band only with complete loss of the 37 kD band (figure e-1). This is strong evidence the antibody detects LPS in the 37 kD band, and this is the same molecular weight as the 37 kD large band seen in figure 1D with the Abcam anti-LPS antibody (upper panel).

Localization of LPS and K99 pili protein in cells in AD and control brains.

E coli LPS (Abcam antibody) and K99 pili protein were detected immunocytochemically in all 11 AD and 7 control brains. LPS was detected in control (figure 2, A and C) and AD brains (figure 2, B and D) in GM (figure 2, A and B) and in periventricular WM (figure 2, C and D). For a control, coimmunoprecipitation of the anti-LPS antibody with LPS completely eliminated all tissue staining by immunofluorescence (figure e-2) or by immunohistochemistry (figure e-3), showing that LPS was being immunostained.

Figure 2
Figure 2 Immunofluorescence of lipopolysaccharide (LPS) in human brains

Immunocytochemistry for LPS showed staining in both control (A, C) and Alzheimer disease (AD) brains (B, D) in gray matter (GM) (A, B) and in periventricular white matter (PVWM, C, D). LPS colocalized with 4',6-diamidino-2-phenylindole (DAPI)–stained nuclei in control GM (E) and WM (G) including ependymal cells (G, arrowheads). The patterns of control LPS staining in the DAPI-stained nuclei varied (E; yellow, green, and white arrowheads). In AD GM, there were large foci of LPS staining that appeared to be plaques in cortex (Ctx) (B, F; white arrow), and other LPS-stained structures that appeared to be the size of nuclei in GM (B, F; yellow arrowheads). LPS staining was detected in control (C, G) and AD (D, H) WM. DAPI staining of nuclei was decreased in AD Ctx (F) and in WM (H) including ventricular ependymal cells (H, white arrowheads), likely indicating cell loss. LPS was detected in all 11 AD brains and all 7 control brains by immunofluorescence. Bar = 25 μm.

LPS was localized in neurons (figures e-4 and e-5), microglia (figure e-6), oligodendrocytes, and oligodendrocyte progenitor cells (figures e-7 and e-8). LPS colocalized with a nuclear marker, DAPI, in control GM (figure 2E) and WM (figure 2G) including ependymal cells (figure 2G, arrowheads). In AD GM there was LPS staining in what appeared to be amyloid plaques in cortex (figure 2, B and F, white arrow). Smaller LPS-stained structures appeared to be nuclei in GM (figure 2, B and F, yellow arrowheads) and WM (figure 2, D and H). Note that ependymal cells were missing in AD brain (figure 2H, arrowheads) and DAPI was absent in many nuclei that were stained with LPS in WM (figure 2H).

K99 pili protein was associated with neuron-like cells in AD cortex (figure 3B) but not in controls (figure 3A). K99 pili protein was localized to control ependymal cells (figure 3C) that were lost in AD brains (figure 3D, arrowheads). K99 pili protein immunostaining of fiber tracts in AD WM (figure 3D) was greater than in controls (figure 3C).

Figure 3
Figure 3 Immunofluorescence of Escherichia coli K99 pili protein in human brains

E coli K99 staining in control cortex (Ctx) was punctate and not associated with 4',6-diamidino-2-phenylindole (DAPI)–stained nuclei (A). In control white matter, K99 staining appeared to be associated with fiber tracts (C). In Alzheimer disease (AD) gray matter (GM), E coli K99 pili protein was often found in pyramidal cells in the cytoplasm and not the nucleus (B, arrowheads). There was intense E coli K99 pili protein staining in AD periventricular white matter (PVWM) (D) with loss of normal DAPI-stained ependymal cells in AD brains (D, arrowheads) compared to controls (C, arrowheads). E coli K99 pili protein was detected in all 11 AD brains and all 7 control brains by immunofluorescence. Bar = 25 μm.

Association of LPS with amyloid plaques in AD brains.

LPS positively stained clusters were frequently observed in AD brains (figure e-9, A1, arrow). Within these clusters, DNA stained with DAPI from coalesced cells and was indistinct (figure e-9, A2 and A3, arrows). Moreover, the coalesced DNA colocalized with Aβ1-40/42 (figure e-9, B1-3, arrows).

LPS and Aβ1-40/42 colocalized in 3 different patterns in AD brains. (1) Clusters composed mainly of LPS particles colocalized with Aβ1-40/42 (figure 4A). (2) Aβ1-40/42 deposits that colocalized with LPS were surrounded by LPS (figure 4, B and C). (3) The most common pattern showed confluent Aβ1-40/42 stained amyloid plaques with scattered LPS particles in them (figure 4D).

Figure 4
Figure 4 Association of lipopolysaccharide (LPS) and Escherichia coli K99 pili protein with amyloid plaques in Alzheimer disease (AD) brains

There were several different patterns of colocalization of LPS and Aβ1-40/42 in AD brains. There were clusters of predominantly LPS particles that colocalized with Aβ1-40/42 (A). There were Aβ1-40/42 deposits that colocalized with LPS and were surrounded by LPS (B, C). Finally, there were confluent Aβ1-40/42-stained amyloid plaques that had scattered LPS particles within them (D). These LPS results contrasted with E coli K99 pili protein, which often surrounded small Aβ1-40/42-stained amyloid plaques (E–G). For larger amyloid plaques (diameter >50 μm), E coli K99 was usually absent (H). Bar = 25 μm.

LPS-stained plaques were surrounded by astrocytes (figure e-10, B1-4, arrows). In AD cortex, LPS was localized in neurons, microglia, oligodendrocytes, and oligodendrocyte progenitor cells (B1-B4, figures e-4 through e-8).

In contrast, K99 pili protein surrounded small Aβ1-40/42 stained amyloid plaques (figure 4, E–G), but was absent around larger amyloid plaques (diameter >50 μm) (figure 4H).

Association of LPS and K99 pili protein with blood vessels.

In control brains, both LPS (figure 5A) and E coli K99 (figure 5C) localized to blood vessels that did not stain for Aβ1-40/42 (figure 5, A and C). In contrast, LPS and Aβ1-40/42 colocalized in vessel walls of AD brains (yellow staining, figure 5B). Aβ1-40/42 was sandwiched by but did not colocalize with K99 pili protein in vessels in AD brains (figure 5D, arrowheads).

Figure 5
Figure 5 Association of lipopolysaccharide (LPS) and Escherichia coli K99 with blood vessels

LPS and E coli K99 were also found in vessels of human brains. In control brains, both LPS (A) and E coli K99 pili protein (C) were localized in blood vessels that did not stain for Aβ1-40/42 (A, C). LPS, E coli K99 pili protein, and Aβ1-40/42 were localized in vessels of Alzheimer disease (AD) brains (B, D). Aβ1-40/42 colocalized (yellow staining) with LPS in vessels in AD brains (B). Aβ1-40/42 was frequently sandwiched by but did not colocalize with E coli K99 pili protein (D, arrowheads). Bar = 25 μm.

E coli DNA in AD and control brains.

PCR with primers for the E coli glutamate decarboxylase B gene (gadB)19 showed the predicted 175 bp DNA fragment, which was the same size in control and AD GM, as well as in the positive control ATCC 8739 E coli strain (figure e-11). The 175 bp amplicon was detected in 9/10 normal control (figure e-11A) and 9/13 AD brains (figure e-11B). Of these, 1/10 control and 4/13 AD samples showed bands of different sizes (figure e-11) of unknown significance. All samples showed low molecular weight bands that likely represented primer interactions. A megablast (optimized for highly similar sequences; NCBI nonredundant nucleotide database) of the DNA sequences (table e-2) of the amplicons from the qPCR reactions showed that DNA from the 3 human controls (table e-2) was 100% identical to 115 E coli strains/substrains/entries in the database, and to 5 Shigella strains. The DNA sequence from one of the AD samples (table e-2) was 100% identical to 7 strains/substrains/entries of E coli, while the DNA from the other AD sample (table e-2) had one nucleotide mismatch from 116 E coli strains/substrains/entries, and one mismatch (99.4% identity) from the same 5 Shigella strains as the other AD sample. One AD sample (AD1), negative on quantitative PCR, was also negative upon sequencing.

DISCUSSION

We demonstrate Gram-negative bacterial LPS, E coli K99 pili protein, and DNA in control and AD brains. K99 and LPS levels were greater in AD compared to control brains. Moreover, LPS colocalized with Aβ1-40/42 in amyloid plaques and with Aβ1-40/42 around blood vessels in AD brains. These data suggest that Gram-negative bacterial molecules are associated with AD pathology.

Though the monoclonal antibodies were raised to E coli molecules, they may not be specific for E coli. PCR showed appropriate size bands for E coli DNA in the majority of AD and control brains. Sequencing the bands showed that though most 100% identical hits were for E coli, there were 100% identical hits for a related Gram-negative family member, Shigella, which is due to the sequence homology between the 2 species. Thus, the data support the presence of proteins and DNA from E coli or Gram-negative bacteria related to E coli.

Our findings complement a recent RNAseq study that showed bacterially encoded 16s RNA sequences in all human brains with Gram-negative α-Proteobacteria representing over 70% of bacterial sequences.16 The other 30% of bacterial classes varied widely, with γ-Proteobacteria, including E coli, being present at <5% of total bacterial transcripts found.16 Thus our data support this previous study.

A major question arises as to how Gram-negative bacterial LPS, proteins and DNA in this study, and α-Proteobacteria molecules16 or Gram-positive bacterial peptidoglycan22,23 in other studies enter brain. In our LPS/ischemia/hypoxia animal model, we showed that LPS increased in rat brain over a period of 3 months after a single intraperitoneal injection that was associated with a parallel increase in IL-1β and granzyme B in brain.15 We postulated that IL-1β-producing monocytes and granzyme B–producing cytotoxic T cells or natural killer cells phagocytized the LPS in the periphery via Toll 4 receptors and carried LPS into brain.15 Gamma Proteobacteria enterobacteriaceae like E coli, and related family members like Salmonella and Shigella, cause diarrheal illness in humans,24 and some strains of E coli are resident in the gastrointestinal tract. The virulence of enterotoxigenic E coli that cause diarrhea are dependent on production of adhesins and enterotoxins, and the E coli K99 pili protein found in control and AD brains is one of the surface antigens in enterotoxigenic (diarrhea) E coli adhesive pili.25 It is tempting to speculate that this study provides another example of a gut-to-brain connection26 with gut being one possible source of brain E coli supporting the concept of AD being a systemic disease.27 E coli from urinary tract and other infections could also be a source for brain bacterial molecules. Finally, since LPS derived from Gram-negative bacteria injures the blood–brain barrier,28 this could promote entry of LPS and other bacterial molecules into the brain.

Previous studies show that sporadic late-onset AD can be associated with infection.9,–,12 Infectious agents previously associated with AD include Spirochetes, P gingivalis, Borrelia burgdorferi, Chlamydophila pneumonia, Helicobacter pylori, C glabrata, various fungi, herpesviruses, and cytomegalovirus.9,–,12 A major difference between previous studies and this one is that LPS colocalized with amyloid plaque and with perivascular amyloid in every AD brain.

LPS is the major component of the outer membrane of Gram-negative bacteria. Gram-negative bacteria include α-Proteobacteria found in human brain16 and include γ-Proteobacteria like E coli, molecules of which were found in brain in this study. LPS was colocalized with Aβ1-40/42 in amyloid plaques and with perivascular Aβ1-40/42 in all AD brains. In our recent animal study, systemic LPS combined with cerebral ischemia/hypoxia produced aggregates of myelin that colocalized with Aβ1-40/42 in adult rat brains and the aggregates had features of amyloid plaques.15 These animal data, combined with the current human brain data, suggest the possibility that LPS in combination with other factors could cause AD neuropathology.

LPS and E coli K99 pili protein in vessels and ependymal cells could contribute to vessel injury29 and ependymal injury17 and WM injury observed in AD brains. There was more K99 pili protein in GM and WM of AD brains, and both WM and GM are consistently damaged in AD.17,30 However, the current human data cannot determine if the bacterial molecules are a cause or consequence of the injury to AD brain.

There are limitations to this study. E coli could contaminate tissue samples. We used sterile techniques, sterile solutions, and sampled the core of frozen tissue blocks to reduce contamination. Evidence against E coli contamination includes the finding that LPS and E coli K99 staining patterns in control and AD brains were different, the staining patterns were consistent in all brains, and levels of K99 and LPS were higher in AD compared to control brains. Studies of brain biopsies obtained during life would help address the possibility of contamination during autopsy, however.

The current study did not test whether there are live bacteria in human brain. However, a recent study found evidence for live bacteria in brain and supports the idea that every organ, including brain, has its own microbiome.16 Since this study focused on E coli proteins and DNA, future studies will be needed to address the potential for other bacteria in AD pathogenesis.

AUTHOR CONTRIBUTIONS

Xinhua Zhan designed the studies, collected data, and wrote the manuscript. Boryana Stamova designed the studies, performed statistical analysis, and made changes to the manuscript. Lee-Way Jin provided brain samples, reviewed samples for correct diagnosis, and made changes to the manuscript. Charles DeCarli provided brain samples, reviewed samples for correct diagnosis, and made changes to the manuscript. Brett Phinney analyzed data and made changes to the manuscript. Frank R. Sharp designed the studies, wrote the manuscript, and made changes to the manuscript.

STUDY FUNDING

This study was supported by NIH/NINDS grant RO1 AG042292 (F.R.S., C.D.), ADC grant AG P30 10129 (C.D.), and grants from The Rotary Coins for Alzheimer's Research Trust (CART) (F.R.S, X.Z.) and an Alzheimer's Disease Research Award from California Department of Public Health (F.R.S., X.Z.).

DISCLOSURE

The authors report no disclosures relevant to the manuscript. Go to Neurology.org for full disclosures.

ACKNOWLEDGMENT

The authors thank the Alzheimer's Disease Center of University of California for providing brain samples.

Footnotes

  • Go to Neurology.org for full disclosures. Funding information and disclosures deemed relevant by the authors, if any, are provided at the end of the article. The Article Processing Charge was paid by the authors.

  • Supplemental data at Neurology.org

  • Received March 8, 2016.
  • Accepted in final form August 24, 2016.

This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially.

REFERENCES

  1. 1.↵
    1. Holmes C,
    2. Butchart J
    . Systemic inflammation and Alzheimer's disease. Biochem Soc Trans 2011;39:898–901.
    OpenUrlAbstract/FREE Full Text
  2. 2.↵
    1. Dunn N,
    2. Mullee M,
    3. Perry VH,
    4. Holmes C
    . Association between dementia and infectious disease: evidence from a case-control study. Alzheimer Dis Assoc Disord 2005;19:91–94.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Tyas SL,
    2. Manfreda J,
    3. Strain LA,
    4. Montgomery PR
    . Risk factors for Alzheimer's disease: a population-based, longitudinal study in Manitoba, Canada. Int J Epidemiol 2001;30:590–597.
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    1. Verreault R,
    2. Laurin D,
    3. Lindsay J,
    4. De Serres G
    . Past exposure to vaccines and subsequent risk of Alzheimer's disease. CMAJ 2001;165:1495–1498.
    OpenUrlAbstract/FREE Full Text
  5. 5.↵
    1. Engelhart MJ,
    2. Geerlings MI,
    3. Meijer J, et al
    . Inflammatory proteins in plasma and the risk of dementia: the Rotterdam Study. Arch Neurol 2004;61:668–672.
    OpenUrlCrossRefPubMed
  6. 6.↵
    1. Schmidt R,
    2. Schmidt H,
    3. Curb JD,
    4. Masaki K,
    5. White LR,
    6. Launer LJ
    . Early inflammation and dementia: a 25-year follow-up of the Honolulu-Asia aging study. Ann Neurol 2002;52:168–174.
    OpenUrlCrossRefPubMed
  7. 7.↵
    1. Imbimbo BP
    . An update on the efficacy of non-steroidal anti-inflammatory drugs in Alzheimer's disease. Expert Opin Investig Drugs 2009;18:1147–1168.
    OpenUrlCrossRefPubMed
  8. 8.↵
    1. Vlad SC,
    2. Miller DR,
    3. Kowall NW,
    4. Felson DT
    . Protective effects of NSAIDs on the development of Alzheimer disease. Neurology 2008;70:1672–1677.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Bibi F,
    2. Yasir M,
    3. Sohrab SS, et al
    . Link between chronic bacterial inflammation and Alzheimer disease. CNS Neurol Disord Drug Targets 2014;13:1140–1147.
    OpenUrl
  10. 10.↵
    1. Singhrao SK,
    2. Harding A,
    3. Poole S,
    4. Kesavalu L,
    5. Crean S
    . Porphyromonas gingivalis periodontal infection and its putative links with Alzheimer's disease. Mediators Inflamm 2015;2015:137357.
    OpenUrl
  11. 11.↵
    1. Noble JM,
    2. Scarmeas N,
    3. Celenti RS, et al
    . Serum IgG antibody levels to periodontal microbiota are associated with incident Alzheimer disease. PLoS One 2014;9:e114959.
    OpenUrl
  12. 12.↵
    1. Civitelli L,
    2. Marcocci ME,
    3. Celestino I, et al
    . Herpes simplex virus type 1 infection in neurons leads to production and nuclear localization of APP intracellular domain (AICD): implications for Alzheimer's disease pathogenesis. J Neurovirol 2015;21:480–490.
    OpenUrl
  13. 13.↵
    1. Chapman MR,
    2. Robinson LS,
    3. Pinkner JS, et al
    . Role of Escherichia coli curli operons in directing amyloid fiber formation. Science 2002;295:851–855.
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    1. Fowler DM,
    2. Koulov AV,
    3. Balch WE,
    4. Kelly JW
    . Functional amyloid: from bacteria to humans. Trends Biochem Sci 2007;32:217–224.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Zhan X,
    2. Cox C,
    3. Ander BP, et al
    . Inflammation combined with ischemia produces myelin injury and plaque-like aggregates of myelin, amyloid-beta and AbetaPP in adult rat brain. J Alzheimers Dis 2015;46:507–523.
    OpenUrl
  16. 16.↵
    1. Branton WG,
    2. Ellestad KK,
    3. Maingat F, et al
    . Brain microbial populations in HIV/AIDS: alpha-proteobacteria predominate independent of host immune status. PLoS One 2013;8:e54673.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Zhan X,
    2. Jickling GC,
    3. Ander BP, et al
    . Myelin injury and degraded myelin vesicles in Alzheimer's disease. Curr Alzheimer Res 2014;11:232–238.
    OpenUrlCrossRefPubMed
  18. 18.↵
    1. Zhan X,
    2. Jickling GC,
    3. Ander BP, et al
    . Myelin basic protein associates with AbetaPP, Abeta1-42, and amyloid plaques in cortex of Alzheimer's disease brain. J Alzheimers Dis 2015;44:1213–1229.
    OpenUrlPubMed
  19. 19.↵
    1. Quinones B,
    2. Swimley MS,
    3. Narm KE,
    4. Patel RN,
    5. Cooley MB,
    6. Mandrell RE
    . O-antigen and virulence profiling of shiga toxin-producing Escherichia coli by a rapid and cost-effective DNA microarray colorimetric method. Front Cell Infect Microbiol 2012;2:61.
    OpenUrl
  20. 20.↵
    1. Braak H,
    2. Braak E
    . Frequency of stages of Alzheimer-related lesions in different age categories. Neurobiol Aging 1997;18:351–357.
    OpenUrlCrossRefPubMed
  21. 21.↵
    1. Klemm P,
    2. Schembri MA
    . Bacterial adhesins: function and structure. International journal of medical microbiology. Int J Med Microbiol 2000;290:27–35.
    OpenUrlCrossRefPubMed
  22. 22.↵
    1. Schrijver IA,
    2. van Meurs M,
    3. Melief MJ, et al
    . Bacterial peptidoglycan and immune reactivity in the central nervous system in multiple sclerosis. Brain 2001;124:1544–1554.
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    1. Visser L,
    2. Melief MJ,
    3. van Riel D, et al
    . Phagocytes containing a disease-promoting Toll-like receptor/Nod ligand are present in the brain during demyelinating disease in primates. Am J Pathol 2006;169:1671–1685.
    OpenUrlCrossRefPubMed
  24. 24.↵
    1. Fischer Walker CL,
    2. Sack D,
    3. Black RE
    . Etiology of diarrhea in older children, adolescents and adults: a systematic review. PLoS Negl Trop Dis 2010;4:e768.
    OpenUrlCrossRefPubMed
  25. 25.↵
    1. Nagy B,
    2. Fekete PZ
    . Enterotoxigenic Escherichia coli (ETEC) in farm animals. Vet Res 1999;30:259–284.
    OpenUrlPubMed
  26. 26.↵
    1. Schmidt C
    . Mental health: thinking from the gut. Nature 2015;518:S12–S15.
    OpenUrlCrossRefPubMed
  27. 27.↵
    1. Khan TK,
    2. Alkon DL
    . Peripheral biomarkers of Alzheimer's disease. J Alzheimers Dis 2015;44:729–744.
    OpenUrl
  28. 28.↵
    1. Erickson MA,
    2. Hartvigson PE,
    3. Morofuji Y,
    4. Owen JB,
    5. Butterfield DA,
    6. Banks WA
    . Lipopolysaccharide impairs amyloid beta efflux from brain: altered vascular sequestration, cerebrospinal fluid reabsorption, peripheral clearance and transporter function at the blood-brain barrier. J Neuroinflammation 2012;9:150.
    OpenUrlCrossRefPubMed
  29. 29.↵
    1. Janota C,
    2. Lemere CA,
    3. Brito MA
    . Dissecting the contribution of vascular Alterations and aging to Alzheimer's disease. Mol Neurobiol 2015;53:3793–3811.
    OpenUrl
  30. 30.↵
    1. Bartzokis G,
    2. Sultzer D,
    3. Lu PH,
    4. Nuechterlein KH,
    5. Mintz J,
    6. Cummings JL
    . Heterogeneous age-related breakdown of white matter structural integrity: implications for cortical “disconnection” in aging and Alzheimer's disease. Neurobiol Aging 2004;25:843–851.
    OpenUrlCrossRefPubMed

Letters: Rapid online correspondence

Comment

REQUIREMENTS

You must ensure that your Disclosures have been updated within the previous six months. Please go to our Submission Site to add or update your Disclosure information.

Your co-authors must send a completed Publishing Agreement Form to Neurology Staff (not necessary for the lead/corresponding author as the form below will suffice) before you upload your comment.

If you are responding to a comment that was written about an article you originally authored:
You (and co-authors) do not need to fill out forms or check disclosures as author forms are still valid
and apply to letter.

Submission specifications:

  • Submissions must be < 200 words with < 5 references. Reference 1 must be the article on which you are commenting.
  • Submissions should not have more than 5 authors. (Exception: original author replies can include all original authors of the article)
  • Submit only on articles published within 6 months of issue date.
  • Do not be redundant. Read any comments already posted on the article prior to submission.
  • Submitted comments are subject to editing and editor review prior to posting.

More guidelines and information on Disputes & Debates

Compose Comment

More information about text formats

Plain text

  • No HTML tags allowed.
  • Web page addresses and e-mail addresses turn into links automatically.
  • Lines and paragraphs break automatically.
Author Information
NOTE: The first author must also be the corresponding author of the comment.
First or given name, e.g. 'Peter'.
Your last, or family, name, e.g. 'MacMoody'.
Your email address, e.g. [email protected]
Your role and/or occupation, e.g. 'Orthopedic Surgeon'.
Your organization or institution (if applicable), e.g. 'Royal Free Hospital'.
Publishing Agreement
NOTE: All authors, besides the first/corresponding author, must complete a separate Publishing Agreement Form and provide via email to the editorial office before comments can be posted.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.

Vertical Tabs

You May Also be Interested in

Back to top
Advertisement

Topics Discussed

Alert Me

Recommended articles